pa2g4b

Ensembl ID:
ENSDARG00000070657
ZFIN ID:
ZDB-GENE-030131-2182
Description:
proliferation-associated 2G4-like [Source:RefSeq peptide;Acc:NP_997806]
Human Orthologue:
PA2G4
Human Description:
proliferation-associated 2G4, 38kDa [Source:HGNC Symbol;Acc:8550]
Mouse Orthologue:
Pa2g4
Mouse Description:
proliferation-associated 2G4 Gene [Source:MGI Symbol;Acc:MGI:894684]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18591 Nonsense Available for shipment Available now
sa16995 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18591
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016248 Nonsense 288 394 10 13
ENSDART00000131486   None 207 None 8

The following transcripts of ENSDARG00000070657 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 25585830)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25371950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTGTTCACTTTGCATGTGTGTTTTTTCAGGGCATTTGAAGATGAGAGT[A/T]AAGCTCGTCTTGGTGTGGTTGAGTGTGCCAAACACGAGCTGCTGCAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016248 Essential Splice Site 313 394 10 13
ENSDART00000131486   None 207 None 8

The following transcripts of ENSDARG00000070657 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 25585907)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25372027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAAACACGAGCTGCTGCAGCCCTTCAGCGTCCTGCAWGAGAAGGAAGG[T/C]GAGGYGCAAGCACAKCARTCAGAAAATGTYACTTTTATATGTAAAACGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Vitiligo: Association analyses identify three susceptibility Loci for vitiligo in the Chinese Han population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link