pex5

Ensembl ID:
ENSDARG00000070654
ZFIN ID:
ZDB-GENE-040426-981
Description:
peroxisomal biogenesis factor 5 [Source:RefSeq peptide;Acc:NP_957450]
Human Orthologue:
PEX5
Human Description:
peroxisomal biogenesis factor 5 [Source:HGNC Symbol;Acc:9719]
Mouse Orthologue:
Pex5
Mouse Description:
peroxisomal biogenesis factor 5 Gene [Source:MGI Symbol;Acc:MGI:1098808]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10186 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103944 Nonsense 420 600 13 15
ENSDART00000123142 Nonsense 498 678 14 16
ENSDART00000145106 Nonsense 413 593 12 14
Genomic Location (Zv9):
Chromosome 16 (position 13823596)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12182687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATTAATTTATGTGAGTTNNNNNNNNNNTGTTTCTCTTAGAGCACTGTTTGGTGAAGTG[C/T]AGACGTTGTTTYTGAATGCAGCGGCGGCTGAGCCCTCGCAGGTGGACCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link