FGD5 (1 of 3)

Ensembl ID:
ENSDARG00000070653
Description:
FYVE, RhoGEF and PH domain containing 5 [Source:HGNC Symbol;Acc:19117]
Human Orthologue:
FGD5
Human Description:
FYVE, RhoGEF and PH domain containing 5 [Source:HGNC Symbol;Acc:19117]
Mouse Orthologue:
Fgd5
Mouse Description:
FYVE, RhoGEF and PH domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2443369]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14523 Nonsense Available for shipment Available now
sa24889 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35058 Nonsense Mutation detected in F1 DNA During 2016
sa21880 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103945 Nonsense 279 534 10 16
Genomic Location (Zv9):
Chromosome 11 (position 18826580)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18243894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACGGCTTCTTTCTGTGCAYGTCAGCTCTTTAGGAGAAAGAGAAGACTG[G/A]TTTCACACACTGAGTCGGGCTATMGCTGATCACGCCGCAGGCCTCAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103945 Essential Splice Site 348 534 11 16
Genomic Location (Zv9):
Chromosome 11 (position 18826282)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18243596
KASP Assay ID:
554-7683.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTTCAGTCTAACACTGCGACGGCATCACTGTAATGCATGCGGAAAGG[T/A]GAACATTTTTTACACAGAGTACATTTGGGTTCACAGATTTGATGTCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35058
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103945 Nonsense 482 534 15 16
Genomic Location (Zv9):
Chromosome 11 (position 18820222)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18237536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAATGTCTGCGTCTGCAGGATAAAGTGGCATCTGAAAGTCTTTCACTG[C/T]AGGGTTTTACTGTGAAGCTGTCGGATCGATCAGAGGGTGAAGACACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103945 Essential Splice Site 523 534 16 16
Genomic Location (Zv9):
Chromosome 11 (position 18819995)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18237309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTATTTAGGATTCTCCAGAAACATAATACAGAAATATATAATTTTGCA[G/T]GTGGGTAAACGCAATGGAAGAGGCCACAGTGTTATAGTATCCAGCGCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link