FGD5 (1 of 3)

Ensembl ID:
ENSDARG00000070653
Description:
FYVE, RhoGEF and PH domain containing 5 [Source:HGNC Symbol;Acc:19117]
Human Orthologue:
FGD5
Human Description:
FYVE, RhoGEF and PH domain containing 5 [Source:HGNC Symbol;Acc:19117]
Mouse Orthologue:
Fgd5
Mouse Description:
FYVE, RhoGEF and PH domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2443369]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4416 Nonsense Mutation detected in F1 DNA During 2014
sa14523 Nonsense Available for shipment Available now
sa24889 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21880 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103945 Nonsense 223 534 8 16
Genomic Location:
Chromosome 11 (position 18826954)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGTGACTGTGTGTGTGTGTNNTGCAGATGAATGATGTGATGCTGTA[C/A]ACCTACCCTCAGCAGGAYGGCAAATACAGACTGAAGAACACACTCACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103945 Nonsense 279 534 10 16
Genomic Location:
Chromosome 11 (position 18826580)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACGGCTTCTTTCTGTGCAYGTCAGCTCTTTAGGAGAAAGAGAAGACTG[G/A]TTTCACACACTGAGTCGGGCTATMGCTGATCACGCCGCAGGCCTCAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103945 Essential Splice Site 348 534 11 16
Genomic Location:
Chromosome 11 (position 18826282)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTTCAGTCTAACACTGCGACGGCATCACTGTAATGCATGCGGAAAGG[T/A]GAACATTTTTTACACAGAGTACATTTGGGTTCACAGATTTGATGTCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103945 Essential Splice Site 523 534 16 16
Genomic Location:
Chromosome 11 (position 18819995)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTATTTAGGATTCTCCAGAAACATAATACAGAAATATATAATTTTGCA[G/T]GTGGGTAAACGCAATGGAAGAGGCCACAGTGTTATAGTATCCAGCGCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b977p0u7