LOC100150844

Ensembl ID:
ENSDARG00000070651
Human Orthologue:
PRKCD
Human Description:
protein kinase C, delta [Source:HGNC Symbol;Acc:9399]
Mouse Orthologue:
Prkcd
Mouse Description:
protein kinase C, delta Gene [Source:MGI Symbol;Acc:MGI:97598]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10046 Nonsense Available for shipment Available now
sa15723 Nonsense Available for shipment Available now
sa4415 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10046
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103943 Nonsense 103 685 2 15
Genomic Location:
Chromosome 11 (position 18788814)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCYGTCATTGCTGAACGCTGTAAAAAAGGCAACGGGCATGCAGAGTTYWG[G/A]GTGGACCTGCAGCCCTCGGGGAAGGTGAKGATGTCCGTCCAGTTTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103943 Nonsense 408 685 10 15
Genomic Location:
Chromosome 11 (position 18779021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATGTGGWGCTGATGGATGATGATGTGGAGTGTAYAATGGTGGAGAAA[C/T]GAGTGTTAGCTTTAGCCTGGGAAAACCCTTTCCTCACACACCTCTAYTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103943 Nonsense 623 685 14 15
Genomic Location:
Chromosome 11 (position 18773065)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGTGGACATGCTTTCTTCAAGACAATCAACTGGCCAGCGCTGGAGAAA[C/T]GAGAGGTGTCWCCTCCGTTCAAGCCAAAAGTGGTACGATTCTGATCTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vqk7hy69