enpp5

Ensembl ID:
ENSDARG00000070625
ZFIN ID:
ZDB-GENE-041014-10
Description:
ectonucleotide pyrophosphatase/phosphodiesterase 5 [Source:RefSeq peptide;Acc:NP_001025347]
Human Orthologue:
ENPP5
Human Description:
ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) [Source:HGNC Symbol;Acc:13717]
Mouse Orthologue:
Enpp5
Mouse Description:
ectonucleotide pyrophosphatase/phosphodiesterase 5 Gene [Source:MGI Symbol;Acc:MGI:1933830]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36999 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36999
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049603 Nonsense 137 512 2 4
ENSDART00000142837 Nonsense 98 473 1 3
Genomic Location (Zv9):
Chromosome 20 (position 18803135)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18831392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACAGGTTTACACGCTGAAAGCCATGGCGTGGTTGCAAACGAAATGTA[C/A]GACCCCATTCACAACCGTTCATTTTCCATTGAGGGTCCTGAAGTGTATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link