si:dkey-117n22.2

Ensembl ID:
ENSDARG00000070624
ZFIN ID:
ZDB-GENE-100921-51
Description:
LOC100003278 protein [Source:UniProtKB/TrEMBL;Acc:A2VCY5]
Human Orthologue:
CACNG7
Human Description:
calcium channel, voltage-dependent, gamma subunit 7 [Source:HGNC Symbol;Acc:13626]
Mouse Orthologue:
Cacng7
Mouse Description:
calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22780 Nonsense Available for shipment Available now
sa36063 Nonsense Mutation detected in F1 DNA During 2017
sa22779 Nonsense Available for shipment Available now
sa11809 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103891 Nonsense 198 346 5 5
ENSDART00000133735 Nonsense 225 373 6 6
Genomic Location (Zv9):
Chromosome 16 (position 14715477)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13073936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTTGTTGTCTCGATGTTGTCCAGGGCGCTGGTGTGATGTCAGTGTA[T/A]CTTTTCATGAAGCGTTATGCAGAGGAGGAGATGTATCGGCCTCACCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103891 Nonsense 210 346 5 5
ENSDART00000133735 Nonsense 237 373 6 6
Genomic Location (Zv9):
Chromosome 16 (position 14715441)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13073900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATGTCAGTGTATCTTTTCATGAAGCGTTATGCAGAGGAGGAGATGTA[T/A]CGGCCTCACCCCACTCTCTATCGCCCCCGTCTTTCCGAGGGCAGTGACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103891 Nonsense 217 346 5 5
ENSDART00000133735 Nonsense 244 373 6 6
Genomic Location (Zv9):
Chromosome 16 (position 14715420)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13073879
KASP Assay ID:
2260-9347.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGCGTTATGCAGAGGAGGAGATGTATCGGCCTCACCCCACTCTCTA[T/G]CGCCCCCGTCTTTCCGAGGGCAGTGACTACAGCGGTCAGTATCTTCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103891 Nonsense 231 346 5 5
ENSDART00000133735 Nonsense 258 373 6 6
Genomic Location (Zv9):
Chromosome 16 (position 14715378)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13073837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTCTATYGCCCCCGTCTTTCCGAGGGCAGYGACTACAGCGGTCAGTA[T/A]CTTCACCCAGAGACCTGGCCTCCACCTCAGCGAGCACGCAGCGCCTCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link