grin2db
- Ensembl ID:
- ENSDARG00000070620
- ZFIN ID:
- ZDB-GENE-100920-7
- Human Orthologue:
- GRIN2D
- Human Description:
- glutamate receptor, ionotropic, N-methyl D-aspartate 2D [Source:HGNC Symbol;Acc:4588]
- Mouse Orthologue:
- Grin2d
- Mouse Description:
- glutamate receptor, ionotropic, NMDA2D (epsilon 4) Gene [Source:MGI Symbol;Acc:MGI:95823]
Alleles
There are 8 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa25008 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa15765 |
Nonsense |
Available for shipment |
Available now |
sa9877 |
Nonsense |
Available for shipment |
Available now |
sa19134 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa44841 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa22781 |
Nonsense |
Available for shipment |
Available now |
sa36065 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa32078 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa25008
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 16 (position 15055693)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
13414152 |
GRCz11 |
16 |
13304272 |
- KASP Assay ID:
- 554-7542.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCTCCCCATTGTTGCTGTGGGAGGGGGAGCAGCTCTGGGCAGGGTACCA[C/T]AGGTAATGCCGTTTACTGAATTGAAATGTGGTCATGTTTTTGTTGCTCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15765
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 16 (position 15048749)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
13407208 |
GRCz11 |
16 |
13297328 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCTTCCACCGCACTCCAATTGGAGGTGATCTTTGAGGWACTGGAGGAGTA[T/A]GATTGGACGGCCTTCTCGGTGGTGTCCACCCGTCACCATGGCTACCAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9877
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 16 (position 14952536)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
13310995 |
GRCz11 |
16 |
13201115 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AAAAACATCCGCAGTAACTATCCAGACATGCACCAATACATGGTCAAGTA[C/A]AACCAGAAGAGTGTGGAGGACGCCATCTCYCACCTCAAGACTGGGTCTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19134
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 16 (position 14946227)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
13304686 |
GRCz11 |
16 |
13194806 |
- KASP Assay ID:
- 2260-9354.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACATGGCTCGTAAAGATGAAGGCTGTAAAGTAATGACCATCGGCTCAGGG[A/T]AAGTATTCGCCACGACTGGATATGGGATCGCCCTGATCAAGAACTCTCGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44841
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 16 (position 14933941)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
13292400 |
GRCz11 |
16 |
13182520 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGAACACCTGGTTTACTGGAGGCTGCGGCACTGCATGAGCAAAATGGGA[C/T]AGTCTGGCAAATTGGACTTCCTTCTCGCCTTCAGCAGGGTGAGAGAGTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22781
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 16 (position 14933224)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
13291683 |
GRCz11 |
16 |
13181803 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTACTATGGACCTATTGATCCAGAGGGACTTGGGCCATGTGTGGACCAA[C/T]AGACAGGTTCTCAAACCCCTAAAACAATCCCCAGAGTCCATCAACAACCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36065
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 16 (position 14932117)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
13290576 |
GRCz11 |
16 |
13180696 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATCTTCCGGTAAGCGGTCAGAGCCAGAGGAAGGTGATGTTGAAGCAGAC[A/T]GAGATGGAGAGGGGGATGGGGATAGAGAAGGAGAGTACTCATCATTTTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32078
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 16 (position 14931940)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
13290399 |
GRCz11 |
16 |
13180519 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGGAGGTGAAGATGATGGGGATGAAAGAGAGGATGAGAGTGGGGGAGGC[A/T]GAGGTAGAGAGAGAAGACCCAAAAGCTCCCATTCGCGGCATAGACCTTCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: