grin2db

Ensembl ID:
ENSDARG00000070620
ZFIN ID:
ZDB-GENE-100920-7
Human Orthologue:
GRIN2D
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 2D [Source:HGNC Symbol;Acc:4588]
Mouse Orthologue:
Grin2d
Mouse Description:
glutamate receptor, ionotropic, NMDA2D (epsilon 4) Gene [Source:MGI Symbol;Acc:MGI:95823]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25008 Nonsense Mutation detected in F1 DNA During 2016
sa15765 Nonsense Available for shipment Available now
sa9877 Nonsense Available for shipment Available now
sa19134 Nonsense Mutation detected in F1 DNA During 2016
sa22781 Nonsense Available for shipment Available now
sa36065 Nonsense Mutation detected in F1 DNA During 2016
sa32078 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103882 Nonsense 166 1959 2 14
ENSDART00000144062 Nonsense 166 1016 3 15
Genomic Location (Zv9):
Chromosome 16 (position 15055693)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13414152
KASP Assay ID:
554-7542.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCCCCATTGTTGCTGTGGGAGGGGGAGCAGCTCTGGGCAGGGTACCA[C/T]AGGTAATGCCGTTTACTGAATTGAAATGTGGTCATGTTTTTGTTGCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15765
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103882 Nonsense 193 1959 3 14
ENSDART00000144062 Nonsense 193 1016 4 15
Genomic Location (Zv9):
Chromosome 16 (position 15048749)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13407208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCCACCGCACTCCAATTGGAGGTGATCTTTGAGGWACTGGAGGAGTA[T/A]GATTGGACGGCCTTCTCGGTGGTGTCCACCCGTCACCATGGCTACCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103882 Nonsense 737 1959 11 14
ENSDART00000144062 Nonsense 737 1016 12 15
Genomic Location (Zv9):
Chromosome 16 (position 14952536)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13310995
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAACATCCGCAGTAACTATCCAGACATGCACCAATACATGGTCAAGTA[C/A]AACCAGAAGAGTGTGGAGGACGCCATCTCYCACCTCAAGACTGGGTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103882 Nonsense 783 1959 12 14
ENSDART00000144062 Nonsense 783 1016 13 15
Genomic Location (Zv9):
Chromosome 16 (position 14946227)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13304686
KASP Assay ID:
2260-9354.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGGCTCGTAAAGATGAAGGCTGTAAAGTAATGACCATCGGCTCAGGG[A/T]AAGTATTCGCCACGACTGGATATGGGATCGCCCTGATCAAGAACTCTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103882 Nonsense 1075 1959 14 14
ENSDART00000144062   None 1016 None 15
Genomic Location (Zv9):
Chromosome 16 (position 14933224)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13291683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTACTATGGACCTATTGATCCAGAGGGACTTGGGCCATGTGTGGACCAA[C/T]AGACAGGTTCTCAAACCCCTAAAACAATCCCCAGAGTCCATCAACAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103882 Nonsense 1444 1959 14 14
ENSDART00000144062   None 1016 None 15
Genomic Location (Zv9):
Chromosome 16 (position 14932117)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13290576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTTCCGGTAAGCGGTCAGAGCCAGAGGAAGGTGATGTTGAAGCAGAC[A/T]GAGATGGAGAGGGGGATGGGGATAGAGAAGGAGAGTACTCATCATTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103882 Nonsense 1503 1959 14 14
ENSDART00000144062   None 1016 None 15
Genomic Location (Zv9):
Chromosome 16 (position 14931940)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13290399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGGTGAAGATGATGGGGATGAAAGAGAGGATGAGAGTGGGGGAGGC[A/T]GAGGTAGAGAGAGAAGACCCAAAAGCTCCCATTCGCGGCATAGACCTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link