ikbke

Ensembl ID:
ENSDARG00000070606
ZFIN IDs:
ZDB-GENE-040718-251, ZDB-GENE-040718-251
Description:
inhibitor of nuclear factor kappa-B kinase subunit epsilon [Source:RefSeq peptide;Acc:NP_001002751]
Human Orthologue:
IKBKE
Human Description:
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon [Source:HGNC Symbol;Ac
Mouse Orthologue:
Ikbke
Mouse Description:
inhibitor of kappaB kinase epsilon Gene [Source:MGI Symbol;Acc:MGI:1929612]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35071 Essential Splice Site Available for shipment Available now
sa2615 Nonsense F2 line generated During 2017
sa30946 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080116 Essential Splice Site None 721 2 22
ENSDART00000129062   None 721 None 20
Genomic Location (Zv9):
Chromosome 11 (position 22236807)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21243038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCTGACTGTTGTGTTTAAGAGAAGTGTTAAGTTCAGGAATAAAACGG[T/A]AACGTAACGTAATTCACTTTTTAATTGGATGAGAGACATGTTTATTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2615
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080116 Nonsense 351 721 10 22
ENSDART00000129062 Nonsense 351 721 8 20
Genomic Location (Zv9):
Chromosome 11 (position 22214544)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21220775
KASP Assay ID:
554-3333.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATCTTTTTTGAGGATGTTCAGGCCCAAACTGGAATTGAACCTGCGGCT[C/T]AACAGTATTTATTTCAAGGCCATCCTCTCATATTAGATCCAAGCATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080116 Nonsense 558 721 16 22
ENSDART00000129062 Nonsense 558 721 14 20
Genomic Location (Zv9):
Chromosome 11 (position 22208527)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21214758
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTCAGAAGATGGAGGTTTTGTTGTCGCAGATTGTTGATGTACATTTC[C/T]AGTACTTCAGGGACAGACAGACAAGAAGTAAGTGGATGTGTGTTTACCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link