A3KP94_DANRE

Ensembl ID:
ENSDARG00000070605
Description:
LOC557782 protein [Source:UniProtKB/TrEMBL;Acc:A3KP94]
Human Orthologue:
B4GALNT2
Human Description:
beta-1,4-N-acetyl-galactosaminyl transferase 2 [Source:HGNC Symbol;Acc:24136]
Mouse Orthologue:
B4galnt2
Mouse Description:
beta-1,4-N-acetyl-galactosaminyl transferase 2 Gene [Source:MGI Symbol;Acc:MGI:1342058]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12224 Nonsense Available for shipment Available now
sa12308 Nonsense Available for shipment Available now
sa26051 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa12224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103858 Nonsense 210 491 7 12
ENSDART00000103858 Nonsense 210 491 7 12
Genomic Location:
Chromosome 3 (position 23342063)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAACTYAATGATCTGYTGTCCARAGTGAGCTACACCAGCACCGTCTA[C/A]CACATCARAACATCAGACCTGGGTGAGAACAGCAGACATGCTYACTTWAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103858 Nonsense 210 491 7 12
ENSDART00000103858 Nonsense 210 491 7 12
Genomic Location:
Chromosome 3 (position 23342063)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAACTYAATGATCTGYTGTCCARAGTGAGCTACACCAGCACCGTCTA[C/A]CACATCARAACATCAGACCTGGGTGAGAACAGCAGACATGCTYACTTWAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103858 Nonsense 269 491 9 12
Genomic Location:
Chromosome 3 (position 23345070)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCATAATAACCAAGACTTTTCTGAGGTATGAGGAGCTGAATATCCTTT[T/G]AAACAGTATCAGGAAGTTTTATCCAAAAATCAAGATCCTTATTGCTGACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3sae6if0