sc:d0375

Ensembl ID:
ENSDARG00000070597
ZFIN ID:
ZDB-GENE-080327-24
Description:
cDNA, clone cssl:d0375 [Source:UniProtKB/TrEMBL;Acc:A8BBF7]
Human Orthologue:
PRELP
Human Description:
proline/arginine-rich end leucine-rich repeat protein [Source:HGNC Symbol;Acc:9357]
Mouse Orthologue:
Prelp
Mouse Description:
proline arginine-rich end leucine-rich repeat Gene [Source:MGI Symbol;Acc:MGI:2151110]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6206 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103846 Nonsense 129 378 1 2
Genomic Location (Zv9):
Chromosome 11 (position 21917693)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 20923924
KASP Assay ID:
554-5095.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARAACAACTACATTGATCAAGTWACAGCGGAATCCTTCAAGAACTGCACT[G/T]AGCTTAAGTGGATAAATCTGGGAAACAACCGGATCCGCTCGGTGGAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link