LOC799449

Ensembl ID:
ENSDARG00000070590
Human Orthologue:
NT5C1A
Human Description:
5'-nucleotidase, cytosolic IA [Source:HGNC Symbol;Acc:17819]
Mouse Orthologue:
Nt5c1a
Mouse Description:
5'-nucleotidase, cytosolic IA Gene [Source:MGI Symbol;Acc:MGI:2155700]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4726 Nonsense Mutation detected in F1 DNA During 2016
sa36498 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa4726
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103830 Nonsense 149 358 4 6
Genomic Location:
Chromosome 17 (position 43593036)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTTTTAGAACGCTTTTGTATGACTGGAGGCAACAGTCCTATTGGTTA[T/A]CTGAAAGCTTACCACACCAACCTTTATCTGTCAGCTGACTCRCTGAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103830 Essential Splice Site 173 358 4 6
Genomic Location:
Chromosome 17 (position 43592964)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTATCTGTCAGCTGACTCGCTGAAAGTCAGAGAAGCCATCGAAGCAGG[T/C]GAGCTGGAGTGCTTTTGGGAATTAATTAAGGGAATAATATATAAATACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link