mrpl35

Ensembl ID:
ENSDARG00000070589
ZFIN ID:
ZDB-GENE-060929-1082
Description:
39S ribosomal protein L35, mitochondrial [Source:RefSeq peptide;Acc:NP_001070193]
Human Orthologue:
MRPL35
Human Description:
mitochondrial ribosomal protein L35 [Source:HGNC Symbol;Acc:14489]
Mouse Orthologue:
Mrpl35
Mouse Description:
mitochondrial ribosomal protein L35 Gene [Source:MGI Symbol;Acc:MGI:1913473]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5634 Nonsense F2 line generated During 2014
sa2930 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa5634
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103827 Nonsense 144 175 4 4
ENSDART00000133665 Nonsense 157 188 4 4
ENSDART00000103827 Nonsense 144 175 4 4
ENSDART00000133665 Nonsense 157 188 4 4
Genomic Location:
Chromosome 17 (position 43557879)
KASP Assay ID:
554-3399.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAAGCGTCTGAGGGAACATGTTTTCTGTAAYAAAACTCAGTGTAAAT[T/A]GCTGGACAAAATGACGTCACCCTACTGGAAAAGAAGGAACTGGTACCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2930
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103827 Nonsense 144 175 4 4
ENSDART00000133665 Nonsense 157 188 4 4
ENSDART00000103827 Nonsense 144 175 4 4
ENSDART00000133665 Nonsense 157 188 4 4
Genomic Location:
Chromosome 17 (position 43557879)
KASP Assay ID:
554-3399.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAAGCGTCTGAGGGAACATGTTTTCTGTAAYAAAACTCAGTGTAAAT[T/A]GCTGGACAAAATGACGTCACCCTACTGGAAAAGAAGGAACTGGTACCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0ry0tqpz