si:ch211-173b8.2

Ensembl ID:
ENSDARG00000070586
ZFIN ID:
ZDB-GENE-070705-82
Description:
si:ch211-173b8.2 [Source:RefSeq peptide;Acc:NP_001096043]
Human Orthologue:
CTGF
Human Description:
connective tissue growth factor [Source:HGNC Symbol;Acc:2500]
Mouse Orthologue:
Ctgf
Mouse Description:
connective tissue growth factor Gene [Source:MGI Symbol;Acc:MGI:95537]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43301 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43301
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103811 Missense 258 351 5 5
Genomic Location (Zv9):
Chromosome 19 (position 30255052)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 13941678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACAGCCTATACCTTTCTCTTTTCAGAGAGGAAAGAAGTGTGTACGAA[C/T]CCCAAAAAGCCAGAGTGGGATGCGTTTCGAGTTGTCTGGATGCCAGAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link