A1L2A0_DANRE

Ensembl ID:
ENSDARG00000070583
Description:
LOC100148744 protein [Source:UniProtKB/TrEMBL;Acc:A1L2A0]
Human Orthologue:
ITPK1
Human Description:
inositol 1,3,4-triphosphate 5/6 kinase [Source:HGNC Symbol;Acc:6177]
Mouse Orthologue:
Itpk1
Mouse Description:
inositol 1,3,4-triphosphate 5/6 kinase Gene [Source:MGI Symbol;Acc:MGI:2446159]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5904 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23161 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103799 Essential Splice Site 157 159 6 6
ENSDART00000124043 None None 367 None 8
Genomic Location:
Chromosome 17 (position 43385741)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAGTATGCTTTTCTCTTAATCTAGTAGCCAWTTAMAACATTTTCAGCC[A/C]AAAACAAAAATATTTTTCTCAGTTTTGCCTYTTTTGTTTACATGACACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103799 None None 159 None 6
ENSDART00000124043 Nonsense 161 367 5 8
Genomic Location:
Chromosome 17 (position 43353909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCCCCGTGTGTCATTCAGAGTTTTATAAACCACAATGCCGTGCTGTA[T/G]AAGGTGTTTGTGGTGGGCGAGTCGTATACTGTGGTGGAAAGACCATCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vow2orum