A1L2A0_DANRE

Ensembl ID:
ENSDARG00000070583
Description:
LOC100148744 protein [Source:UniProtKB/TrEMBL;Acc:A1L2A0]
Human Orthologue:
ITPK1
Human Description:
inositol 1,3,4-triphosphate 5/6 kinase [Source:HGNC Symbol;Acc:6177]
Mouse Orthologue:
Itpk1
Mouse Description:
inositol 1,3,4-triphosphate 5/6 kinase Gene [Source:MGI Symbol;Acc:MGI:2446159]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5904 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23161 Nonsense Mutation detected in F1 DNA During 2016
sa36494 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36493 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103799 Essential Splice Site 157 159 6 6
ENSDART00000124043   None 367 None 8
Genomic Location (Zv9):
Chromosome 17 (position 43385741)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43350416
KASP Assay ID:
554-3644.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAGTATGCTTTTCTCTTAATCTAGTAGCCAWTTAMAACATTTTCAGCC[A/C]AAAACAAAAATATTTTTCTCAGTTTTGCCTYTTTTGTTTACATGACACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103799   None 159 None 6
ENSDART00000124043 Nonsense 161 367 5 8
Genomic Location (Zv9):
Chromosome 17 (position 43353909)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43318584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCCCCGTGTGTCATTCAGAGTTTTATAAACCACAATGCCGTGCTGTA[T/G]AAGGTGTTTGTGGTGGGCGAGTCGTATACTGTGGTGGAAAGACCATCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36494
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103799   None 159 None 6
ENSDART00000124043 Essential Splice Site 187 367 5 8
Genomic Location (Zv9):
Chromosome 17 (position 43353831)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43318506
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTGGTGGAAAGACCATCACTCAAGAACTTCCCATCTGGACCGTCTGG[T/G]AAACCTTCAACTCACACTTCAACTCTTTCGAAACGTTATTTCCATGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103799   None 159 None 6
ENSDART00000124043 Nonsense 218 367 7 8
Genomic Location (Zv9):
Chromosome 17 (position 43347309)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43311984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTCTTTGGTTTGTATTTTGACAGAGAGATAATGTAGAAGGTGTTTCC[C/T]AGCCACCAAACGATGATGTCATCAGGGAACTGTGCAAGTCTCTGCGGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link