cr855317.1

Ensembl ID:
ENSDARG00000070575
ZFIN ID:
ZDB-GENE-100922-12
Description:
LOC556725 protein [Source:UniProtKB/TrEMBL;Acc:A1L261]
Human Orthologue:
FAM131B
Human Description:
family with sequence similarity 131, member B [Source:HGNC Symbol;Acc:22202]
Mouse Orthologue:
Fam131b
Mouse Description:
family with sequence similarity 131, member B Gene [Source:MGI Symbol;Acc:MGI:1923406]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10860 Splice Site, Nonsense Available for shipment Available now
sa17919 Nonsense Available for shipment Available now
sa11747 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103750 Splice Site, Nonsense 22 426 2 8
ENSDART00000122299 Splice Site, Nonsense 22 442 2 8
Genomic Location:
Chromosome 16 (position 19490478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTTTCTCTACAGCCTCAGATGGAGTTCCYGTYCAGAAGGWTGGGGAA[C/T]AGGTAAGAAAACTGCAGTTTATTTCARCATCCATTGTACACTAGCCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103750 Nonsense 77 426 4 8
ENSDART00000122299 Nonsense 77 442 4 8
Genomic Location:
Chromosome 16 (position 19497350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCGCTCTATGAAGGACAAGGTGACAAAACCGACAGCAATGGCTCAGGGG[C/T]GAGTGGCACACATGATTGAGTGGCAGAGCTGGGGCATGCAGACAGTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103750 Nonsense 194 426 6 8
ENSDART00000122299 Nonsense 194 442 6 8
Genomic Location:
Chromosome 16 (position 19512299)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTACAGACCAGATGCACCATTCCTCTGCAGAAGTGTGGCCCCACAATTA[T/A]GTCTCCCAGGGTCTTTACTGCCTTTCTTCCTCTGATGCGTGGGAGCCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8gy6i6ya