ppp4ca

Ensembl ID:
ENSDARG00000070570
ZFIN ID:
ZDB-GENE-030131-4433
Description:
Serine/threonine-protein phosphatase 4 catalytic subunit A [Source:UniProtKB/Swiss-Prot;Acc:A8WGP3]
Human Orthologue:
PPP4C
Human Description:
protein phosphatase 4, catalytic subunit [Source:HGNC Symbol;Acc:9319]
Mouse Orthologue:
Ppp4c
Mouse Description:
protein phosphatase 4, catalytic subunit Gene [Source:MGI Symbol;Acc:MGI:1891763]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33179 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103741 Essential Splice Site None 311 1 9
Genomic Location (Zv9):
Chromosome 3 (position 26791265)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26112971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACAAAAGAAACAACGAATGCCTGAACGAGATTAACCTAAAGCCCAAG[G/A]TATTTATTTGCATTTCGCCTTAATTTTAATGTTTGAAATTTAATCATTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link