atad5a

Ensembl ID:
ENSDARG00000070568
ZFIN ID:
ZDB-GENE-070912-20
Description:
Si:ch211-11k18.10 protein [Source:UniProtKB/TrEMBL;Acc:A9JSS3]
Human Orthologue:
ATAD5
Human Description:
ATPase family, AAA domain containing 5 [Source:HGNC Symbol;Acc:25752]
Mouse Orthologue:
Atad5
Mouse Description:
ATPase family, AAA domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2442925]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20016 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6894 Nonsense Mutation detected in F1 DNA During 2014
sa15159 Nonsense Available for shipment Available now
sa14858 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103733 Essential Splice Site 17 1778 None 23
ENSDART00000103734 Essential Splice Site None 766 None 9
ENSDART00000103737 Essential Splice Site 17 1778 None 22

The following transcripts of ENSDARG00000070568 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 26790151)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGGGGTTGTTGCATTGCCAGCTGTCATGGAGGATTTCGAGGGTCAGG[T/G]ATGTGTCTTATTAATAATGTGTAACTGTTAATCTGTTATGGCTGTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103733 Nonsense 840 1778 10 23
ENSDART00000103734 None None 766 None 9
ENSDART00000103737 Nonsense 840 1778 9 22

The following transcripts of ENSDARG00000070568 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 26778398)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCATTTAGGTTTCTTGTCAGAAGACCGAGTTTTCTGAGCCAATYAGA[C/T]AGTGTCTTTTGGAGAAGATGAGAATCTCCAATCCATCCTTCCCTCATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15159
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103733 Nonsense 1605 1778 21 23
ENSDART00000103734 Nonsense 593 766 7 9
ENSDART00000103737 Nonsense 1605 1778 20 22

The following transcripts of ENSDARG00000070568 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 26772269)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTKGACTCCTCACTASACTATCAAGCCTCGCAGTCRGARGGGTTTTGC[C/T]GACCCCAGGATTCTGGCTGGACYRGTGCAGAGATCAAGAGCGGGATGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14858
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103733 Nonsense 1687 1778 21 23
ENSDART00000103734 Nonsense 675 766 7 9
ENSDART00000103737 Nonsense 1687 1778 20 22

The following transcripts of ENSDARG00000070568 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 26772023)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGAGGARAAGCTGAGGAGGAGCTCACACTCTCYGTGGCTCCACACAGA[C/T]AGAGCTTCAGCCTCACACAGACTACACCTTGTGAACCAAGGTAGGAATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d7ci7i3v