A9JTG6_DANRE

Ensembl ID:
ENSDARG00000070567
Description:
LOC100001129 protein [Source:UniProtKB/TrEMBL;Acc:A9JTG6]
Human Orthologue:
CADPS
Human Description:
Ca++-dependent secretion activator [Source:HGNC Symbol;Acc:1426]
Mouse Orthologue:
Cadps
Mouse Description:
Ca2+-dependent secretion activator Gene [Source:MGI Symbol;Acc:MGI:1350922]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33932 Nonsense Mutation detected in F1 DNA During 2016
sa18103 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042683 Nonsense 54 1329 1 30
Genomic Location:
Chromosome 6 (position 41186626)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCGAGAGCTCCGACAGGCTTCAGCCCTCTAGCCGAGGCTCCAGCGCC[C/T]GACCGACCAGCCCGAGCCCGTCGGCCGCCAGCGAGGAGAAGGAGGACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18103
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042683 Essential Splice Site 1273 1329 30 30
Genomic Location:
Chromosome 6 (position 41375096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAAAAAGAAAAACAAAGCTTAAAACCTGCTAATTTTTCTCATTCCTGT[A/T]GAAGAAATACCGGGATTTTAGACTGCAGGGTGTCCTTGATTCGACGTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link