si:ch73-33i10.5

Ensembl ID:
ENSDARG00000070565
ZFIN ID:
ZDB-GENE-100922-23
Human Orthologue:
ADAP2
Human Description:
ArfGAP with dual PH domains 2 [Source:HGNC Symbol;Acc:16487]
Mouse Orthologue:
Adap2
Mouse Description:
ArfGAP with dual PH domains 2 Gene [Source:MGI Symbol;Acc:MGI:2663075]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6893 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017
sa9788 Nonsense Available for shipment Available now
sa40066 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103729 Essential Splice Site 30 382 2 11
ENSDART00000131288 Splice Site None 378 None 11

The following transcripts of ENSDARG00000070565 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 26764624)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26139612
KASP Assay ID:
554-5359.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTCATTAACTCTGATGTATAAATTTGCATGCATTTTTTTTNCTTTT[G/C]AAGATCCAGATTGGGCTTCATGTAARTTAGGAATATTTGTGTGTCTAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103729 Nonsense 65 382 2 11
ENSDART00000131288 Nonsense 64 378 2 11

The following transcripts of ENSDARG00000070565 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 26764518)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26139718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGAACTCATCGCAATCTTCCCACTATAAGTCGTATCAAGTCCATTCGCT[T/A]AGACTTCTGGGATGATGAACTTGTGCAGGTAAAAATKACYTTGTGCGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103729 Nonsense 355 382 10 11
ENSDART00000131288 Nonsense 351 378 10 11

The following transcripts of ENSDARG00000070565 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 26754017)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26150219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCGGCAGTTTGTCTTCATGTGTGAACAGGAGCGTGATCAAAGAGAGTG[G/A]GTGGAGGCCTTGAAAACCGTTATCTCGAAACCCATGATGCCACAAGATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link