si:ch211-105d11.3

Ensembl ID:
ENSDARG00000070553
ZFIN ID:
ZDB-GENE-041008-25
Description:
mRNA cap guanine-N7 methyltransferase [Source:UniProtKB/Swiss-Prot;Acc:Q1MTD3]
Human Orthologue:
RNMT
Human Description:
RNA (guanine-7-) methyltransferase [Source:HGNC Symbol;Acc:10075]
Mouse Orthologue:
Rnmt
Mouse Description:
RNA (guanine-7-) methyltransferase Gene [Source:MGI Symbol;Acc:MGI:1915147]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44910 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23481 Nonsense Available for shipment Available now
sa5919 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088917 Essential Splice Site 109 400 3 11
ENSDART00000103675 Essential Splice Site 109 400 3 12
Genomic Location (Zv9):
Chromosome 19 (position 13277540)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGTCTACATGCGCAATTTCAACAACTGGTTGAAGAGTGTGCTTATTGG[T/A]GAGAAGAAGCGCTTGCTTATGTTTAACTCCCAAAACAAGCATGTTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088917 Nonsense 119 400 4 11
ENSDART00000103675 Nonsense 119 400 4 12
Genomic Location (Zv9):
Chromosome 19 (position 13277679)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12736025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGTGTTGGTTTTCTCAGCTGAGATCTTGGACAAGGTCAGGCAAAAA[C/T]GAAGAGAGGTGACTGTACTGGATCTGGGCTGTGGAAAAGGAGGAGACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088917 Nonsense 246 400 6 11
ENSDART00000103675 Nonsense 246 400 6 12
Genomic Location (Zv9):
Chromosome 19 (position 13281265)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12739611
KASP Assay ID:
554-3938.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGACTCCGGCCTGGAGGATTCTTCATCGGGACAACTCCTGATGCATA[T/G]GAGCTGGTGTAAGATNNNNNNCACACACACACACACACACACACACACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link