si:ch211-105d11.3

Ensembl ID:
ENSDARG00000070553
ZFIN ID:
ZDB-GENE-041008-25
Description:
mRNA cap guanine-N7 methyltransferase [Source:UniProtKB/Swiss-Prot;Acc:Q1MTD3]
Human Orthologue:
RNMT
Human Description:
RNA (guanine-7-) methyltransferase [Source:HGNC Symbol;Acc:10075]
Mouse Orthologue:
Rnmt
Mouse Description:
RNA (guanine-7-) methyltransferase Gene [Source:MGI Symbol;Acc:MGI:1915147]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23481 Nonsense Available for shipment Available now
sa5919 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088917 Nonsense 119 400 4 11
ENSDART00000103675 Nonsense 119 400 4 12
Genomic Location (Zv9):
Chromosome 19 (position 13277679)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12736025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGTGTTGGTTTTCTCAGCTGAGATCTTGGACAAGGTCAGGCAAAAA[C/T]GAAGAGAGGTGACTGTACTGGATCTGGGCTGTGGAAAAGGAGGAGACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088917 Nonsense 246 400 6 11
ENSDART00000103675 Nonsense 246 400 6 12
Genomic Location (Zv9):
Chromosome 19 (position 13281265)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12739611
KASP Assay ID:
554-3938.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGACTCCGGCCTGGAGGATTCTTCATCGGGACAACTCCTGATGCATA[T/G]GAGCTGGTGTAAGATNNNNNNCACACACACACACACACACACACACACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link