msgn1

Ensembl ID:
ENSDARG00000070546
ZFIN ID:
ZDB-GENE-030722-1
Description:
Mesogenin-1 [Source:UniProtKB/Swiss-Prot;Acc:Q90ZL1]
Human Orthologue:
MSGN1
Human Description:
mesogenin 1 [Source:HGNC Symbol;Acc:14907]
Mouse Orthologue:
Msgn1
Mouse Description:
mesogenin 1 Gene [Source:MGI Symbol;Acc:MGI:1860483]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33349 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103659 Nonsense 36 131 1 1
Genomic Location (Zv9):
Chromosome 4 (position 16682)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 292959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCCGTGAGGACAGGTCATTTGGAGACAGCGCGTCCTCGCCGGAGTCC[G/T]AGTCCTTCGATTCTGCCTGCTCGTCGCCCGACGCGCGCTCCAGCCCCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link