top1l

Ensembl ID:
ENSDARG00000070545
ZFIN ID:
ZDB-GENE-060616-217
Description:
topoisomerase (DNA) I, like [Source:RefSeq peptide;Acc:NP_001037789]
Human Orthologue:
TOP1
Human Description:
topoisomerase (DNA) I [Source:HGNC Symbol;Acc:11986]
Mouse Orthologue:
Top1
Mouse Description:
topoisomerase (DNA) I Gene [Source:MGI Symbol;Acc:MGI:98788]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21911 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5843 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2597 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa21911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065949 Essential Splice Site 601 758 17 21
ENSDART00000065949 Essential Splice Site 601 758 17 21

The following transcripts of ENSDARG00000070545 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 26240238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAACGCCTCCATCACACTACAGCAGCAGCTGAACGAACTCACTAACTG[T/G]AAGTCCTGCACGCACCAGATTGAGCAGAGCTGCTGGAAACGCATCATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065949 Essential Splice Site 601 758 17 21
ENSDART00000065949 Essential Splice Site 601 758 17 21

The following transcripts of ENSDARG00000070545 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 26240238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAACGCCTCCATCACACTACAGCAGCAGCTGAACGAACTCACTAACTG[T/A]AAGTCCTGCACGCACCAGATTGAGCAGAGCTGCTGGAAACGCATCATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2597
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065949 Nonsense 612 758 18 21

The following transcripts of ENSDARG00000070545 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 26240345)
KASP Assay ID:
554-2781.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGTGTTTGTTTAGCTGAAGATAATGTTCCTGCGAAGATCCTCTCCTA[C/A]AATCGGGCCAAYCGAGCGGTAGCCATCCTGTGTAACCACCAGAGGGCACC
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Hatching:Pec-fin
ZFS:0000034
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Pec-fin
ZFS:0000034
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Pec-fin
ZFS:0000034
inner ear
ZFA:0000217
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Pec-fin
ZFS:0000034
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
12:3858416-3859000 3858416 -1 2.99 × 10-25 -2.4 0 gngt2b ENSDARG00000089997
23:2769601-2769959 2769959 1 4.14 × 10-24 3.8 16 top1 ENSDARG00000086775
5:48101731-48102400 48101731 -1 5.40 × 10-21 1.0 -2 hapln1a ENSDARG00000089769
25:38414701-38415139 38415139 1 5.85 × 10-20 -1.3 -2 slc1a2b ENSDARG00000009563
25:34827000-34827200 34827000 -1 1.02 × 10-19 2.0 2 rps27.2 ENSDARG00000090186

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mmb6tg0f