grin2ab

Ensembl ID:
ENSDARG00000070543
ZFIN ID:
ZDB-GENE-070424-223
Description:
Novel protein similar to vertebrate glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A)
Human Orthologue:
GRIN2A
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 2A [Source:HGNC Symbol;Acc:4585]
Mouse Orthologue:
Grin2a
Mouse Description:
glutamate receptor, ionotropic, NMDA2A (epsilon 1) Gene [Source:MGI Symbol;Acc:MGI:95820]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1696 Nonsense F2 line generated During 2017
sa19422 Nonsense Available for shipment Available now
sa39547 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1696
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103652 Nonsense 912 1445 12 12
ENSDART00000137900 Nonsense 912 1445 14 14
Genomic Location (Zv9):
Chromosome 1 (position 7843672)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8083477
KASP Assay ID:
554-1642.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTTCGCCCAAACGCCCCATGAGTAGCATTCTCCCTCCTACATCAGGGT[T/A]GCTGGAATTAATGGGTGGAGGAAAAGGCAACAACCTCGCTCCGAAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103652 Nonsense 1097 1445 12 12
ENSDART00000137900 Nonsense 1097 1445 14 14
Genomic Location (Zv9):
Chromosome 1 (position 7843116)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8082921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCACAGTGCTCACATCTACTCTCAGAGCAGCCAGGGGAGTCAGATTTA[C/A]TCCATTGACTCTATTGACCAGGAGCACGGGCTGCACTATCCTGATATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103652 Nonsense 1226 1445 12 12
ENSDART00000137900 Nonsense 1226 1445 14 14
Genomic Location (Zv9):
Chromosome 1 (position 7842731)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8082536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCGATGCCTGCCTGCACTCGGGCAACCTGTATGACATCAGTGAAGAT[C/T]AGTTTCTCCATCCAGATGGTCGGGGCACTGGAGGTGGAAGTGTTGACAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link