mafbb

Ensembl ID:
ENSDARG00000070542
ZFIN ID:
ZDB-GENE-010605-4
Description:
Kreisler (mouse) maf-related leucine zipper homolog 2.2 [Source:RefSeq peptide;Acc:NP_571917]
Human Orthologue:
MAFB
Human Description:
v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) [Source:HGNC Symbol;Acc:6408]
Mouse Orthologue:
Mafb
Mouse Description:
v-maf musculoaponeurotic fibrosarcoma oncogene family, protein B (avian) Gene [Source:MGI Symbol;Acc

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7349 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103650 Missense 104 318 1 1
Genomic Location:
Chromosome 11 (position 26317267)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCACGGGCGCGTACCCGCAGCACGCAGACCCACACTGCCTTGAACTGA[C/T]CCACGAKGACGTCCGGGAAGCTTTAAGCTCTAATCTCATGCATGCACACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ahbkwodm