ripply2

Ensembl ID:
ENSDARG00000070535
ZFIN ID:
ZDB-GENE-060113-2
Description:
Protein ripply2 [Source:UniProtKB/Swiss-Prot;Acc:Q2WG79]
Human Orthologue:
RIPPLY2
Human Description:
ripply2 homolog (zebrafish) [Source:HGNC Symbol;Acc:21390]
Mouse Orthologue:
Ripply2
Mouse Description:
ripply2 homolog (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:2685968]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40196 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103631 Nonsense 45 109 2 3
Genomic Location (Zv9):
Chromosome 4 (position 681586)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 899502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTCTTTCTTTACTTCAACAGCCTTATAAAAGACCAGCCGATGATGAA[C/T]AGCACAAGCTCTCCATCTTCAAACACCCAGTCAAGTATGTCAAACACTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link