CACNA1H (3 of 3)

Ensembl ID:
ENSDARG00000070528
Description:
calcium channel, voltage-dependent, T type, alpha 1H subunit [Source:HGNC Symbol;Acc:1395]
Human Orthologue:
CACNA1H
Human Description:
calcium channel, voltage-dependent, T type, alpha 1H subunit [Source:HGNC Symbol;Acc:1395]
Mouse Orthologue:
Cacna1h
Mouse Description:
calcium channel, voltage-dependent, T type, alpha 1H subunit Gene [Source:MGI Symbol;Acc:MGI:1928842

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15566 Nonsense Available for shipment Available now
sa1681 Essential Splice Site, Missense Available for shipment Available now
sa16883 Essential Splice Site Available for shipment Available now
sa18685 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1668 Nonsense Available for shipment Available now
sa18648 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103611 Nonsense 293 2016 6 41
ENSDART00000141604 Nonsense 411 1660 9 33

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 1 (position 7410208)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGATGGGCGGATATCATGTATTATGTCATGGATGCTCATTCCTTTTA[C/A]AACTTCATCTATTTCATCTTCCTTATCATCGTAAGTGCACARTAATTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103611 Missense 478 2016 7 41
ENSDART00000141604 Essential Splice Site 596 1660 10 33
Genomic Location:
Chromosome 1 (position 7412788)
KASP Assay ID:
554-1627.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGGCTTGAGGCTCGGGATGAACTATCCCACCATCCTGCCCTCCAAAAT[G/A]TACACAAATTCACATGCTCGTGGAGTAAAAGCTCCAGCTTTCCATCATGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103611 Essential Splice Site 845 2016 16 41
ENSDART00000141604 Essential Splice Site 834 1660 15 33
Genomic Location:
Chromosome 1 (position 7435018)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TMCTCTTCAATTTACTGGTTGCCATCTTAGTAGAGGGTTTCCAAGCAGAG[G/A]TAAGATRTCAGATTTTGGYCAGWTTWACTAACAGTTTGCACCAGCACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103611 Essential Splice Site 1297 2016 27 41
ENSDART00000141604 Essential Splice Site 1176 1660 22 33

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 1 (position 7452533)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAATACAAATGGATCCGTCGGAAGTACAACTTTGATAACCTGGGTCAG[G/A]TAGGACACACTCACAAAAACACACACACATACACATAGACTTTAACAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103611 Nonsense 1584 2016 36 41
ENSDART00000141604 Nonsense 1463 1660 30 33

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 1 (position 7472160)
KASP Assay ID:
554-1615.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCATTAACTTTGATTCAGATTGCACTGAGGAGAACCCCTGTGAGGGTT[T/A]GAGCAGACATGCCACATTTCAGAACTTCGGCATGGCTTTCCTTACTCTCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa18648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103611 Nonsense 1990 2016 41 41
ENSDART00000141604 None None 1660 None 33
Genomic Location:
Chromosome 1 (position 7479745)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAAAGGATAAAATGAGTCCGCCRTGCATCTCCATTGAGCCTCCCGCT[G/T]AATCTGAGGTTGTCAGTCAGGAGTGCTCCTCAGTCCTGCGGCGACGGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/02jkr7h0