cacna1i

Ensembl ID:
ENSDARG00000070522
ZFIN ID:
ZDB-GENE-060503-324
Description:
Novel protein similar to vertebrate calcium channel, voltage-dependent, alpha 1 family subunit (CANN
Human Orthologue:
CACNA1I
Human Description:
calcium channel, voltage-dependent, T type, alpha 1I subunit [Source:HGNC Symbol;Acc:1396]
Mouse Orthologue:
Cacna1i
Mouse Description:
calcium channel, voltage-dependent, alpha 1I subunit Gene [Source:MGI Symbol;Acc:MGI:2178051]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15653 Nonsense Available for shipment Available now
sa20022 Nonsense Mutation detected in F1 DNA During 2014
sa10549 Nonsense Available for shipment Available now
sa6897 Nonsense Mutation detected in F1 DNA During 2014
sa5204 Nonsense Mutation detected in F1 DNA During 2014
sa20023 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15653
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085216 Nonsense 260 1547 6 27
ENSDART00000145615 Nonsense 181 1106 5 18
Genomic Location:
Chromosome 3 (position 29386724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATCTTGTCCTCAGCACATCTGGCCTCRCCCTTCCCACACCATATTAT[C/T]AGCCTGAGGAGGATGACGAGCGGCCCTTCATCTGCTCGTTGGCTCAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085216 Nonsense 296 1547 6 27
ENSDART00000145615 Nonsense 217 1106 5 18
Genomic Location:
Chromosome 3 (position 29386834)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTCCTGCAGCGATGTGCCTGCTCGGAGAGAGGGCGGACGGGAGTGCTG[T/A]CTGGATAAAGAGGACGCTCTTCACCGGCAGGCTCTGGGTCTGAGCGCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085216 Nonsense 395 1547 8 27
ENSDART00000145615 Nonsense 316 1106 7 18
Genomic Location:
Chromosome 3 (position 29400207)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGGATTTCATTATTTTCAAGCTGTATCTCTCCTTCCTGTTCCAGATT[G/T]GATCTTTCTTCATGATTAATCTGTGCCTGGTGGTCATTGCCACTCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085216 Nonsense 416 1547 8 27
ENSDART00000145615 Nonsense 337 1106 7 18
Genomic Location:
Chromosome 3 (position 29400270)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTAATCTGTGCCTGGTGGTCATTGCCACTCAGTTTTCGGAGACCAAA[C/T]AGCGAGAGCACCAGCTGATGCAAGAGCAACGTGCTCGCTACCTGTCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085216 Nonsense 932 1547 16 27
ENSDART00000145615 Nonsense 853 1106 15 18
Genomic Location:
Chromosome 3 (position 29432207)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGYTTTATTTATTGACTCACAATTTGCATTCTGTGCATTAGTGTCCAGGA[C/T]GAGCATCTCTTTACCACAATTGGGGACGCCCCGCACGGCCAGGAATATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085216 Nonsense 1431 1547 25 27
ENSDART00000145615 None None 1106 None 18
Genomic Location:
Chromosome 3 (position 29462695)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAATCCGATGTGCTGATTTCTCTCAGAGGCCCAGAAGTTGCCCTACTA[T/A]GCCAGTTATAGTCATGTACGGCTGATGATCCACACCCTGTGCACCAGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)
  • Schizophrenia: Genome-wide association study implicates HLA-C*01:02 as a risk factor at the major histocompatibility complex locus in schizophrenia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ft2uvcan