LOC100149254

Ensembl ID:
ENSDARG00000070513
Human Orthologue:
BRPF3
Human Description:
bromodomain and PHD finger containing, 3 [Source:HGNC Symbol;Acc:14256]
Mouse Orthologue:
Brpf3
Mouse Description:
bromodomain and PHD finger containing, 3 Gene [Source:MGI Symbol;Acc:MGI:2146836]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14656 Nonsense Available for shipment Available now
sa19007 Nonsense Mutation detected in F1 DNA During 2014
sa10310 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103570 Nonsense 316 1214 1 12
Genomic Location:
Chromosome 11 (position 26663030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCCCGACCCGTMGATTGTGWCCTCTGTCCAAACMGAGGGGGTGCATTC[A/T]AAMAAAMCAGCGATGGAAGTTGGGCMCACGTCATCTGTGCCATATGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103570 Nonsense 374 1214 1 12
Genomic Location:
Chromosome 11 (position 26662856)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAGCTCACCTGTTACCTGTGCAAACAGAAAGGCAGGGGCGCGTCTATT[C/T]AGTGCCACAAAGCCAACTGCTACAGGGCGTTTCACGTCACCTGTGCGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103570 Nonsense 420 1214 1 12
Genomic Location:
Chromosome 11 (position 26662718)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCGGCACCAATGGCACMACTTTTACTGTGAAGAAGACTGCTTATTGC[G/T]AAAACCACTCACCTCCTGGCACKGGAACAGAGGGGTATGAAGATAACGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/69jtjs5j