LOC100151589

Ensembl ID:
ENSDARG00000070511
Human Orthologues:
GRID1, GRID2, GRIN3A, GRIN3B
Human Descriptions:
glutamate receptor, ionotropic, delta 1 [Source:HGNC Symbol;Acc:4575]
glutamate receptor, ionotropic, delta 2 [Source:HGNC Symbol;Acc:4576]
glutamate receptor, ionotropic, N-methyl-D-aspartate 3A [Source:HGNC Symbol;Acc:16767]
glutamate receptor, ionotropic, N-methyl-D-aspartate 3B [Source:HGNC Symbol;Acc:16768]
Mouse Orthologues:
Grid1, Grid2, Grin3a, Grin3b
Mouse Descriptions:
glutamate receptor ionotropic, NMDA3A Gene [Source:MGI Symbol;Acc:MGI:1933206]
glutamate receptor, ionotropic, delta 1 Gene [Source:MGI Symbol;Acc:MGI:95812]
glutamate receptor, ionotropic, delta 2 Gene [Source:MGI Symbol;Acc:MGI:95813]
glutamate receptor, ionotropic, NMDA3B Gene [Source:MGI Symbol;Acc:MGI:2150393]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11729 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103566 Nonsense 323 465 8 10
Genomic Location:
Chromosome 11 (position 26677008)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAAAGCGAAGGARGGAAATTATGCGTTCATTGGGGAATCGGTGTCCT[T/A]GGACTTGGCAGTGGCRCGGCATTGTGAGCTGGTCCGTGCACATGAGGTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/27omvbht