LOC555897

Ensembl ID:
ENSDARG00000070507
Human Orthologue:
TRPC4
Human Description:
transient receptor potential cation channel, subfamily C, member 4 [Source:HGNC Symbol;Acc:12336]
Mouse Orthologue:
Trpc4
Mouse Description:
transient receptor potential cation channel, subfamily C, member 4 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24873 Nonsense Mutation detected in F1 DNA During 2015
sa30939 Nonsense Mutation detected in F1 DNA During 2015
sa9768 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080789 Nonsense 263 934 2 10
Genomic Location:
Chromosome 10 (position 26475386)
KASP Assay ID:
554-7677.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGTGTAAACAGTTCGCCAAAGACCTGCTCGACCAAACACGCAGCTCC[A/T]GAGAGCTCGAGCTGATTCTGAACTACAAAGATGATATAAATCTTCTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080789 Nonsense 326 934 3 10
Genomic Location:
Chromosome 10 (position 26472080)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCGCGTCTCGCTGGTATGATGAGTTTCCAGGCTGGAGACGCCGCCATT[G/A]GGCCAGCAAGTTCATGACCTGTATCTTCATCGGACTTCTCTTCCCTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080789 Nonsense 777 934 10 10
Genomic Location:
Chromosome 10 (position 26465178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCGGTACGAGGTGATGGGAATGATGAAGGGCACTAAAACTGGCATGT[C/A]GACCTCAAAAGGAAATACAGCAGAMTCAAGCCTTGTGTATCCCGAGAACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4mo84fme