trpc5

Ensembl ID:
ENSDARG00000070504
ZFIN ID:
ZDB-GENE-040812-1
Description:
transient receptor potential cation channel, subfamily C, member 5 [Source:RefSeq peptide;Acc:NP_00
Human Orthologue:
TRPC5
Human Description:
transient receptor potential cation channel, subfamily C, member 5 [Source:HGNC Symbol;Acc:12337]
Mouse Orthologue:
Trpc5
Mouse Description:
transient receptor potential cation channel, subfamily C, member 5 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3325 Essential Splice Site F2 line generated During 2014
sa5799 Essential Splice Site F2 line generated During 2014
sa19436 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3325
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040502 None None 984 None 13
ENSDART00000131294 Essential Splice Site None 1045 3 12
ENSDART00000140495 Essential Splice Site None 570 3 7
ENSDART00000040502 None None 984 None 13
ENSDART00000131294 Essential Splice Site None 1045 3 12
ENSDART00000140495 Essential Splice Site None 570 3 7

The following transcripts of ENSDARG00000070504 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 9754049)
KASP Assay ID:
554-2635.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCATATATATCAAATGATTATAGCATCTTTTTTTTTTTTCTTCCAGCA[G/A]CATCCATCATGAATCCCATGTCACATCTATACTACAAAAAGAGCAGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5799
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040502 None None 984 None 13
ENSDART00000131294 Essential Splice Site None 1045 3 12
ENSDART00000140495 Essential Splice Site None 570 3 7
ENSDART00000040502 None None 984 None 13
ENSDART00000131294 Essential Splice Site None 1045 3 12
ENSDART00000140495 Essential Splice Site None 570 3 7

The following transcripts of ENSDARG00000070504 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 9754049)
KASP Assay ID:
554-2635.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAWCATATATATCAAATGATTATAGCATCTTTTTTTTTTTTCTTCCAGCA[G/A]CATCCATCATGAATCCCATGTCACATCTATACTACAAAAAGAGCAGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040502 Nonsense 225 984 2 13
ENSDART00000131294 Nonsense 228 1045 4 12
ENSDART00000140495 Nonsense 228 570 4 7

The following transcripts of ENSDARG00000070504 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 9739318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGCCCTCTCCAGCGAGGATCCCATCCTGACCGCCTTCAGACTGGGCTG[G/A]GAACTCAAGGAGCTCAGCAAAGTGGAGAACGAGTTTCGGCAGGAGTACGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zu5ud2u1