trpc5

Ensembl ID:: ENSDARG00000070504
ZFIN ID:: ZDB-GENE-040812-1
Description:: transient receptor potential cation channel, subfamily C, member 5 [Source:RefSeq peptide;Acc:NP_00
Human Orthologue:: TRPC5
Human Description:: transient receptor potential cation channel, subfamily C, member 5 [Source:HGNC Symbol;Acc:12337]
Mouse Orthologue:: Trpc5
Mouse Description:: transient receptor potential cation channel, subfamily C, member 5 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 3 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa3325	Essential Splice Site	F2 line generated	During 2015
sa5799	Essential Splice Site	F2 line generated	During 2015
sa19436	Nonsense	Available for shipment	Available now

Mutation Details

Allele Name:: sa3325
Current Status:: F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000040502		None	984	None	13
ENSDART00000131294	Essential Splice Site	None	1045	3	12
ENSDART00000140495	Essential Splice Site	None	570	3	7
ENSDART00000040502		None	984	None	13
ENSDART00000131294	Essential Splice Site	None	1045	3	12
ENSDART00000140495	Essential Splice Site	None	570	3	7

The following transcripts of ENSDARG00000070504 do not overlap with this mutation:

ENSDART00000139060

Genomic Location:: Chromosome 1 (position 9754049)
KASP Assay ID:: 554-2635.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TATCATATATATCAAATGATTATAGCATCTTTTTTTTTTTTCTTCCAGCA[G/A]CATCCATCATGAATCCCATGTCACATCTATACTACAAAAAGAGCAGCTAC
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa5799
Current Status:: F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000040502		None	984	None	13
ENSDART00000131294	Essential Splice Site	None	1045	3	12
ENSDART00000140495	Essential Splice Site	None	570	3	7
ENSDART00000040502		None	984	None	13
ENSDART00000131294	Essential Splice Site	None	1045	3	12
ENSDART00000140495	Essential Splice Site	None	570	3	7

The following transcripts of ENSDARG00000070504 do not overlap with this mutation:

ENSDART00000139060

Genomic Location:: Chromosome 1 (position 9754049)
KASP Assay ID:: 554-2635.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TAWCATATATATCAAATGATTATAGCATCTTTTTTTTTTTTCTTCCAGCA[G/A]CATCCATCATGAATCCCATGTCACATCTATACTACAAAAAGAGCAGCTAC
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa19436
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: G > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000040502	Nonsense	225	984	2	13
ENSDART00000131294	Nonsense	228	1045	4	12
ENSDART00000140495	Nonsense	228	570	4	7

The following transcripts of ENSDARG00000070504 do not overlap with this mutation:

ENSDART00000139060

Genomic Location:: Chromosome 1 (position 9739318)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: ATCGCCCTCTCCAGCGAGGATCCCATCCTGACCGCCTTCAGACTGGGCTG[G/A]GAACTCAAGGAGCTCAGCAAAGTGGAGAACGAGTTTCGGCAGGAGTACGA
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Smoking behavior: Genome-wide and candidate gene association study of cigarette smoking behaviors. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for TRPC5

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: