
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
trpc5
- Ensembl ID:
- ENSDARG00000070504
- ZFIN ID:
- ZDB-GENE-040812-1
- Description:
- transient receptor potential cation channel, subfamily C, member 5 [Source:RefSeq peptide;Acc:NP_00
- Human Orthologue:
- TRPC5
- Human Description:
- transient receptor potential cation channel, subfamily C, member 5 [Source:HGNC Symbol;Acc:12337]
- Mouse Orthologue:
- Trpc5
- Mouse Description:
- transient receptor potential cation channel, subfamily C, member 5 Gene [Source:MGI Symbol;Acc:MGI:1
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa3325 | Essential Splice Site | F2 line generated | During 2018 |
sa5799 | Essential Splice Site | F2 line generated | During 2018 |
sa19436 | Nonsense | Available for shipment | Available now |
sa32604 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32603 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa3325
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040502 | None | 984 | None | 13 | |
ENSDART00000131294 | Essential Splice Site | None | 1045 | 3 | 12 |
ENSDART00000140495 | Essential Splice Site | None | 570 | 3 | 7 |
ENSDART00000040502 | None | 984 | None | 13 | |
ENSDART00000131294 | Essential Splice Site | None | 1045 | 3 | 12 |
ENSDART00000140495 | Essential Splice Site | None | 570 | 3 | 7 |
The following transcripts of ENSDARG00000070504 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 9754049)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 9893835 GRCz11 1 10577946 - KASP Assay ID:
- 554-2635.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATCATATATATCAAATGATTATAGCATCTTTTTTTTTTTTCTTCCAGCA[G/A]CATCCATCATGAATCCCATGTCACATCTATACTACAAAAAGAGCAGCTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5799
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040502 | None | 984 | None | 13 | |
ENSDART00000131294 | Essential Splice Site | None | 1045 | 3 | 12 |
ENSDART00000140495 | Essential Splice Site | None | 570 | 3 | 7 |
ENSDART00000040502 | None | 984 | None | 13 | |
ENSDART00000131294 | Essential Splice Site | None | 1045 | 3 | 12 |
ENSDART00000140495 | Essential Splice Site | None | 570 | 3 | 7 |
The following transcripts of ENSDARG00000070504 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 9754049)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 9893835 GRCz11 1 10577946 - KASP Assay ID:
- 554-2635.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAWCATATATATCAAATGATTATAGCATCTTTTTTTTTTTTCTTCCAGCA[G/A]CATCCATCATGAATCCCATGTCACATCTATACTACAAAAAGAGCAGCTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19436
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040502 | Nonsense | 225 | 984 | 2 | 13 |
ENSDART00000131294 | Nonsense | 228 | 1045 | 4 | 12 |
ENSDART00000140495 | Nonsense | 228 | 570 | 4 | 7 |
The following transcripts of ENSDARG00000070504 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 9739318)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 9879104 GRCz11 1 10563215 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCGCCCTCTCCAGCGAGGATCCCATCCTGACCGCCTTCAGACTGGGCTG[G/A]GAACTCAAGGAGCTCAGCAAAGTGGAGAACGAGTTTCGGCAGGAGTACGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32604
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040502 | Nonsense | 420 | 984 | 5 | 13 |
ENSDART00000131294 | Nonsense | 437 | 1045 | 6 | 12 |
ENSDART00000140495 | Nonsense | 437 | 570 | 6 | 7 |
The following transcripts of ENSDARG00000070504 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 9693633)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 9833419 GRCz11 1 10517530 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGATTAAGGAGATGTGGGATGGAGGTTTTAACGAGTACGTCCATGACTG[G/A]TGGAACCTGATGGACTTTGCTATGAATTCTCTCTATTTGGCCACCATTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32603
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040502 | Nonsense | 760 | 984 | 11 | 13 |
ENSDART00000131294 | Nonsense | 781 | 1045 | 12 | 12 |
ENSDART00000140495 | None | 570 | None | 7 |
The following transcripts of ENSDARG00000070504 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 9663780)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 9803566 GRCz11 1 10487677 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACGAGGTTTTAGACCTTCTCGGCAACCGAAAGCCTCCCCGGCGGAACTA[T/A]TCATCCAGCAGCGAGGCCACACTTCGAGACGAGGTCAGCGACGACGGCGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Smoking behavior: Genome-wide and candidate gene association study of cigarette smoking behaviors. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: