phyhipl

Ensembl ID:
ENSDARG00000070498
ZFIN ID:
ZDB-GENE-040927-27
Description:
Phytanoyl-CoA hydroxylase-interacting protein-like [Source:UniProtKB/Swiss-Prot;Acc:A4QNW7]
Human Orthologue:
PHYHIPL
Human Description:
phytanoyl-CoA 2-hydroxylase interacting protein-like [Source:HGNC Symbol;Acc:29378]
Mouse Orthologue:
Phyhipl
Mouse Description:
phytanoyl-CoA hydroxylase interacting protein-like Gene [Source:MGI Symbol;Acc:MGI:1918161]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa467 Nonsense Available for shipment Available now
sa18474 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103536 Nonsense 34 377 2 6
ENSDART00000134608   None 331 None 5
Genomic Location (Zv9):
Chromosome 12 (position 8125371)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7421229
KASP Assay ID:
554-0199.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGAGGACATGATGAAGAATCTCAGCCTGGACGCCATCCAGCTTTGTGAG[A/T]GAGAAGGTAAGAAAGTGTGCGTCTATTCCTTCGCTAAATTCTCCAGTCGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa18474
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103536 Nonsense 182 377 5 6
ENSDART00000134608 Nonsense 136 331 4 5
Genomic Location (Zv9):
Chromosome 12 (position 8177681)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7473539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCACACAGTTKATGGAGAAAGCAGAGGTGATCGCCGGCAGAATGCTG[C/T]GATTYTCYGTCTTTTATCSAAACCAACACARAGAGTACTTCGACCATGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link