FRMD7 (1 of 2)

Ensembl ID:
ENSDARG00000070495
Description:
FERM domain containing 7 [Source:HGNC Symbol;Acc:8079]
Human Orthologue:
FRMD7
Human Description:
FERM domain containing 7 [Source:HGNC Symbol;Acc:8079]
Mouse Orthologue:
Frmd7
Mouse Description:
FERM domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2686379]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32601 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17945 Nonsense Available for shipment Available now
sa13710 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109141 Essential Splice Site 46 678 2 11
Genomic Location (Zv9):
Chromosome 1 (position 9518002)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9657788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACAGGTCTGGCTTGAACTCCTTAAACCAGTGGCTAAGCAAATCAAAA[G/A]TGAGTTTTATGCTTATTAAGCTCATTTACAGTAATGGGGAACAGGAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17945
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109141 Nonsense 526 678 11 11
Genomic Location (Zv9):
Chromosome 1 (position 9506699)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9646485
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGGACTAGGGCTGAGGGCTGGGTTGAATAGGAAACTGGACTTGAGC[A/T]GAGTGGAAGCAGGTCATTATAGTGATGACTCCACCTTCCAGACTGGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13710
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109141 Nonsense 624 678 11 11
Genomic Location (Zv9):
Chromosome 1 (position 9506403)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9646189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGGCACAAGTAGTTACAGTGATTCAGATTCAGACACCTTCTACCCCTA[T/A]TTTCCCACACTGGGAAAAGTGGTACRTTCTGGWCCATTGGCACGCATGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link