FRMD7 (1 of 2)

Ensembl ID:
ENSDARG00000070495
Description:
FERM domain containing 7 [Source:HGNC Symbol;Acc:8079]
Human Orthologue:
FRMD7
Human Description:
FERM domain containing 7 [Source:HGNC Symbol;Acc:8079]
Mouse Orthologue:
Frmd7
Mouse Description:
FERM domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2686379]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17945 Nonsense Available for shipment Available now
sa13710 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17945
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109141 Nonsense 526 678 11 11
Genomic Location:
Chromosome 1 (position 9506699)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGGACTAGGGCTGAGGGCTGGGTTGAATAGGAAACTGGACTTGAGC[A/T]GAGTGGAAGCAGGTCATTATAGTGATGACTCCACCTTCCAGACTGGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13710
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109141 Nonsense 624 678 11 11
Genomic Location:
Chromosome 1 (position 9506403)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGGCACAAGTAGTTACAGTGATTCAGATTCAGACACCTTCTACCCCTA[T/A]TTTCCCACACTGGGAAAAGTGGTACRTTCTGGWCCATTGGCACGCATGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lqdp633u