pdgfra

Ensembl ID:
ENSDARG00000070494
ZFIN ID:
ZDB-GENE-990415-208
Description:
Pdgfra [Source:UniProtKB/TrEMBL;Acc:B0CM00]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43428 Nonsense Mutation detected in F1 DNA During 2017
sa43427 Nonsense Mutation detected in F1 DNA During 2017
sa29348 Nonsense Mutation detected in F1 DNA During 2017
sa271 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa43428
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103510 Nonsense 148 625 3 10
Genomic Location (Zv9):
Chromosome 20 (position 22457197)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22571228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAAACCCACATTCTGAAGTGATGCTCAGAGATCTGCAGAGCGGGGAT[G/T]AGGTTACTGTGCTTTATGACCCCAAACTTGGCTTTTTTGGTACAATACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103510 Nonsense 168 625 3 10
Genomic Location (Zv9):
Chromosome 20 (position 22457135)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22571166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTATGACCCCAAACTTGGCTTTTTTGGTACAATACCGCCAGGACAATA[C/A]GTCTGTGAGACAACTGTGAATGGCAAAACAGTGCGGAGCATCATTTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103510 Nonsense 359 625 7 10
Genomic Location (Zv9):
Chromosome 20 (position 22450565)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22564596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTAATATAACTACAAAAATTGCAATGCCTTCTTTCCTACAAAGGTA[T/A]GAAAATATTCTGATTCTCCGACACCCTGTAGAAGAAGACAGCGGCATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa271
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103510 Nonsense 513 625 9 10
Genomic Location (Zv9):
Chromosome 20 (position 22449497)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22563528
KASP Assay ID:
554-2795.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTTGTGCCGTCCATGACCCCGTTTGAAAACCACGTGCTGACRAGTTA[T/A]GATGAAATGGAGATTCCCTGCCGTGTGACGGATCCCAGTGCCAGCGTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link