fgf21

Ensembl ID:
ENSDARG00000070492
ZFIN ID:
ZDB-GENE-060623-2
Description:
fibroblast growth factor 21 [Source:RefSeq peptide;Acc:NP_001038789]
Human Orthologue:
FGF21
Human Description:
fibroblast growth factor 21 [Source:HGNC Symbol;Acc:3678]
Mouse Orthologue:
Fgf21
Mouse Description:
fibroblast growth factor 21 Gene [Source:MGI Symbol;Acc:MGI:1861377]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10019 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103511 Essential Splice Site 99 194 3 4
Genomic Location:
Chromosome 3 (position 27134477)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACATCTCTCTACCTCTGCGTCGATGATCAAGACAAGCTGAAAGGACAGG[T/A]ATGAATAGAAGTACTCCATTGCAATGATGYAMTATTCAGTTAAAAACCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n2f5fo04