tspan13b

Ensembl ID:
ENSDARG00000070479
ZFIN ID:
ZDB-GENE-041010-45
Description:
tetraspanin-13 [Source:RefSeq peptide;Acc:NP_001005970]
Human Orthologue:
TSPAN13
Human Description:
tetraspanin 13 [Source:HGNC Symbol;Acc:21643]
Mouse Orthologue:
Tspan13
Mouse Description:
tetraspanin 13 Gene [Source:MGI Symbol;Acc:MGI:1913359]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23548 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23548
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103474 Essential Splice Site 179 203 5 6
ENSDART00000145396 Essential Splice Site 179 210 5 6
Genomic Location:
Chromosome 19 (position 31642197)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTACTGCGCTTCGTCGGGGGAATCGGCCTCTTCTTCAGCTTCACTGAG[G/A]TGAGACTGAGAAATAAACCTTAGATTTAATAGTCGTTCGACCCTTCGTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a346fdxa