dnajc2

Ensembl ID:
ENSDARG00000070477
ZFIN ID:
ZDB-GENE-040426-1912
Description:
dnaJ homolog subfamily C member 2 [Source:RefSeq peptide;Acc:NP_997976]
Human Orthologue:
DNAJC2
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 2 [Source:HGNC Symbol;Acc:13192]
Mouse Orthologue:
Dnajc2
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 2 Gene [Source:MGI Symbol;Acc:MGI:99470]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15804 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103463 Nonsense 6 618 1 17
ENSDART00000123089   None 231 None 6
Genomic Location (Zv9):
Chromosome 4 (position 1644991)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1935791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTAAGTCGTCCGTGTGTCTGAATTAGCGAAAATGTTGACGGAGGCGT[T/A]AGAGGGGCAGCTTACGGTGGTTTATAACACCGTCGCCGGTAAGTGNNACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link