khdrbs1b

Ensembl ID:
ENSDARG00000070475
ZFIN ID:
ZDB-GENE-040426-2344
Description:
KH domain containing, RNA binding, signal transduction associated 1b [Source:RefSeq peptide;Acc:NP_
Human Orthologue:
KHDRBS1
Human Description:
KH domain containing, RNA binding, signal transduction associated 1 [Source:HGNC Symbol;Acc:18116]
Mouse Orthologue:
Khdrbs1
Mouse Description:
KH domain containing, RNA binding, signal transduction associated 1 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23547 Essential Splice Site Available for shipment Available now
sa43302 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23547
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103471 Essential Splice Site 272 352 6 9

The following transcripts of ENSDARG00000070475 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31600428)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 30767717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGCGGATGCCTCCACCCCCTCAGACCCAAGAGTCCTATGATGAATATG[T/C]ACGTGTTTTATTTAAATAACTATCCTCTGAATTTGCTTTGAAGATATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103471 Nonsense 339 352 9 9

The following transcripts of ENSDARG00000070475 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31597629)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 30764918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACACCACGTACTGCTGCTGCCGCCGGTGGAAAAGCTCCCACTCAGAGA[C/T]AGACTAAACCTGGGTTCAGGGAACACCCCTATGGACGATACTAAGTCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link