arid3b

Ensembl ID:
ENSDARG00000070474
ZFIN ID:
ZDB-GENE-070209-182
Description:
AT-rich interactive domain-containing protein 3B [Source:RefSeq peptide;Acc:NP_001076471]
Human Orthologue:
ARID3B
Human Description:
AT rich interactive domain 3B (BRIGHT-like) [Source:HGNC Symbol;Acc:14350]
Mouse Orthologue:
Arid3b
Mouse Description:
AT rich interactive domain 3B (BRIGHT-like) Gene [Source:MGI Symbol;Acc:MGI:1930768]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24702 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103470 Nonsense 377 537 7 9
Genomic Location:
Chromosome 25 (position 29862417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCATGCTGCCAGCTCGTCTCCCCTTAGCCCTGGCTCTGGGGCATCAG[C/T]AGCAGCTGGCACGTGCCGCCACCCTGGAGCAGCTGAGGGAGAGGCTGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d0sjxhmy