tarbp2

Ensembl ID:
ENSDARG00000070471
ZFIN ID:
ZDB-GENE-030131-8085
Description:
RISC-loading complex subunit tarbp2 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXR1]
Human Orthologue:
TARBP2
Human Description:
TAR (HIV-1) RNA binding protein 2 [Source:HGNC Symbol;Acc:11569]
Mouse Orthologue:
Tarbp2
Mouse Description:
TAR (HIV) RNA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:103027]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14842 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103455 Nonsense 305 346 7 7
Genomic Location:
Chromosome 6 (position 46663595)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGGCTTTGTTCATTCAGAGGAGCGCAGTTTGAGTGGCCTATATCARTG[T/A]CTGGTGGAATTATCCACACAGCCTATTACCGTCTGCCATGGATTTGCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8cmykz45