si:dkey-15j16.4

Ensembl ID:
ENSDARG00000070470
ZFIN ID:
ZDB-GENE-030131-6288
Description:
Putative E3 ubiquitin-protein ligase SH3RF1 [Source:UniProtKB/Swiss-Prot;Acc:A5D8S5]
Human Orthologue:
SH3RF1
Human Description:
SH3 domain containing ring finger 1 [Source:HGNC Symbol;Acc:17650]
Mouse Orthologue:
Sh3rf1
Mouse Description:
SH3 domain containing ring finger 1 Gene [Source:MGI Symbol;Acc:MGI:1913066]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43432 Nonsense Mutation detected in F1 DNA During 2017
sa43433 Nonsense Mutation detected in F1 DNA During 2017
sa37020 Nonsense Mutation detected in F1 DNA During 2017
sa23692 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050559 Nonsense 121 880 2 12
ENSDART00000132007 Nonsense 121 857 2 12
Genomic Location (Zv9):
Chromosome 20 (position 23729237)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23848038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAATGGATCGGCAGTGGCGGGGGTCCGAGCGCAGGGTGCCGGGGGAAGC[C/T]AAAGGGATCCTGGTCCCACAGGGGGACAATCTCAGCGTGTCCAAGCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050559 Nonsense 769 880 11 12
ENSDART00000132007 Nonsense 746 857 11 12
Genomic Location (Zv9):
Chromosome 20 (position 23815133)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23933934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAATGGCTCTGTCTGGGTCAGCAGGGCACAACGGACGCATTGGTGCCTG[T/A]CCTATGGATTCGGAGCTATCGATGTCCTCCTCTTCATCAAACACAGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050559 Nonsense 826 880 12 12
ENSDART00000132007 Nonsense 803 857 12 12
Genomic Location (Zv9):
Chromosome 20 (position 23817287)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23936088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTGTTCATTTTTTTCTAATCATGTTCTGTTCCTCTTCCTCCAGGTA[T/G]CGTGTGGTGGTGTCCTATCCTCCCCAAAGTGAAGCAGAGCTGGAACTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050559 Nonsense 832 880 12 12
ENSDART00000132007 Nonsense 809 857 12 12
Genomic Location (Zv9):
Chromosome 20 (position 23817305)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23936106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAATCATGTTCTGTTCCTCTTCCTCCAGGTATCGTGTGGTGGTGTCCTA[T/A]CCTCCCCAAAGTGAAGCAGAGCTGGAACTCAAAGAGGGAGACATTGTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link