NP_001008591.1

Ensembl ID:
ENSDARG00000070456
Description:
hypothetical protein LOC494048 [Source:RefSeq peptide;Acc:NP_001008591]
Human Orthologue:
TSPAN5
Human Description:
tetraspanin 5 [Source:HGNC Symbol;Acc:17753]
Mouse Orthologue:
Tspan5
Mouse Description:
tetraspanin 5 Gene [Source:MGI Symbol;Acc:MGI:1928096]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30799 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30799
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080053 Essential Splice Site 150 271 4 9
ENSDART00000101130 Essential Splice Site 150 271 4 9
Genomic Location (Zv9):
Chromosome 1 (position 11158085)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11299737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGAGACGACATTGACCTACAGAATCTCATCGATTTCACACAAGATTAT[G/T]TAAGAACGCACATAAAAATAAAAAACAAAAGGGTTTTCTTTAAGGTGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link