si:ch211-194b7.4

Ensembl ID:
ENSDARG00000070455
ZFIN ID:
ZDB-GENE-100922-188
Human Orthologue:
C9orf5
Human Description:
chromosome 9 open reading frame 5 [Source:HGNC Symbol;Acc:1363]
Mouse Orthologue:
D730040F13Rik
Mouse Description:
RIKEN cDNA D730040F13 gene Gene [Source:MGI Symbol;Acc:MGI:2445107]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22856 Essential Splice Site Available for shipment Available now
sa17756 Essential Splice Site Available for shipment Available now
sa36155 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22856
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103407 Essential Splice Site 174 605 2 13
ENSDART00000147438   None 432 None 11
Genomic Location (Zv9):
Chromosome 16 (position 29399438)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27275122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACCGATCAAAGGCCTGACACATTTCTTGCTTCGCGTGGACACTAAGG[T/A]AATGCCTTATGTAGACAAACCCACACAAAAGTGCTCGCCTGTCTGCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103407 Essential Splice Site 300 605 6 13
ENSDART00000147438 Essential Splice Site 127 432 4 11
Genomic Location (Zv9):
Chromosome 16 (position 29387269)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27263043
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYAAGTTTTGGAGCTGTGGGACCGTCTTTATCAGTCTTGGATTGTGAAGG[T/A]AATTAAAAAANCTCAGCTGCACACAATCCATGTCTTGTAAAAGTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103407 Nonsense 401 605 9 13
ENSDART00000147438 Nonsense 228 432 7 11
Genomic Location (Zv9):
Chromosome 16 (position 29385954)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27261728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAGGTGATTTTCCTGACCACACTTTTTTACCTGCTGAGCTCCAGTGGT[G/T]AATACTATAAACCTGTGAAATGGGTTATCAGCCTCACTCCCCTCTCCCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link