pde6h

Ensembl ID:
ENSDARG00000070439
ZFIN ID:
ZDB-GENE-040426-1754
Description:
phosphodiesterase 6H, cGMP-specific, cone, gamma [Source:RefSeq peptide;Acc:NP_957079]
Human Orthologue:
PDE6H
Human Description:
phosphodiesterase 6H, cGMP-specific, cone, gamma [Source:HGNC Symbol;Acc:8790]
Mouse Orthologue:
Pde6h
Mouse Description:
phosphodiesterase 6H, cGMP-specific, cone, gamma Gene [Source:MGI Symbol;Acc:MGI:1925850]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20604 Essential Splice Site Available for shipment Available now
sa12265 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103373 Essential Splice Site 48 73 2 3
Genomic Location (Zv9):
Chromosome 6 (position 269898)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 332002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGAAGGGCTTCGGAGACGACATCCCAGGAATGGAGGGTCTCGGCACAG[G/A]TAATGCGGAGTTTACACACCCTAAACTAAATCAACACAAGTGCTGTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12265
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103373 Essential Splice Site 49 73 3 3
Genomic Location (Zv9):
Chromosome 6 (position 269582)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 326595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTTTGAATGACATGAGGCTGACGGTTTTCCTCCTCTGGTCTGTCGAC[A/T]GAYATCACTGTGATCTGCCCGTGGGAAGCGTTTGGAGACATGGAGCTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link