si:ch211-244p18.3

Ensembl ID:
ENSDARG00000070432
ZFIN ID:
ZDB-GENE-041014-72
Description:
INO80 complex homolog 1 [Source:RefSeq peptide;Acc:NP_001038584]
Human Orthologue:
INO80
Human Description:
INO80 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:26956]
Mouse Orthologue:
Ino80
Mouse Description:
INO80 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915392]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43459 Essential Splice Site Mutation detected in F1 DNA During 2017
sa765 Essential Splice Site F2 line generated During 2017
sa15927 Essential Splice Site Available for shipment Available now
sa23725 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103333   None 277 None 7
ENSDART00000103336   None 1555 None 35
ENSDART00000127757 Essential Splice Site 268 270 8 8
ENSDART00000128806   None 1552 None 36
Genomic Location (Zv9):
Chromosome 20 (position 28371143)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28442446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTCTTCAACTGTAATGACTCTAATTTTAACCATTTTATTTTATTTCA[G/T]AAAAATAAATAACAGTTTCATGTCTTTATTAATCCTGCCATCTAAATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa765
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103333   None 277 None 7
ENSDART00000103336 Essential Splice Site 435 1555 9 35
ENSDART00000127757   None 270 None 8
ENSDART00000128806 Essential Splice Site 433 1552 10 36
Genomic Location (Zv9):
Chromosome 20 (position 28369683)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28440986
KASP Assay ID:
554-0671.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGACATCGGTGGAGGAGTCATGGTCAACGTCAGCCAGGAGGACTATGG[T/C]GAGGGCTTTTTTTACTGTTTATGAATGATTATTCACGGAAATGGGTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103333   None 277 None 7
ENSDART00000103336 Essential Splice Site 435 1555 9 35
ENSDART00000127757   None 270 None 8
ENSDART00000128806 Essential Splice Site 433 1552 10 36
Genomic Location (Zv9):
Chromosome 20 (position 28369683)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28440986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGACATCGGTGGAGGAGTCATGGTCAACGTCAGCCAGGAGGACTATGG[T/C]GAGGGYTTTTTTTACTGTYTATGAATGATTATTCACGGAAATGGRTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103333   None 277 None 7
ENSDART00000103336 Nonsense 1033 1555 25 35
ENSDART00000127757   None 270 None 8
ENSDART00000128806 Nonsense 1030 1552 26 36
Genomic Location (Zv9):
Chromosome 20 (position 28340550)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28411853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTAGGTGACTTCAGTACCCCTGGAACGCTACTGTGCAGATCGCAGCGCC[G/T]AGTATGAATGGAGGTTAATGCGTGACGGGGGGAGTCTCATTGCTAAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link