LOC100151181

Ensembl ID:
ENSDARG00000070428
Human Orthologue:
SMAD4
Human Description:
SMAD family member 4 [Source:HGNC Symbol;Acc:6770]
Mouse Orthologue:
Smad4
Mouse Description:
MAD homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:894293]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4664 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25017 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103341 Essential Splice Site 209 568 4 11
Genomic Location:
Chromosome 16 (position 31096982)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCACTTCATCTGTAACTCTCTACCCCAACCTGCCCCTTTCTCCACCCC[G/A]TAAGTAYAGCAAAACTTTGATTAAGCARACCAGTTGACAGAGTAKWTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103341 Nonsense 532 568 11 11
Genomic Location:
Chromosome 16 (position 31089797)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCCTGCGCCTTAGTTTTGTGAAGGGCTGGGGACCCGACTACCCTCGA[C/T]AGACCATCAAACAGACACCGTGCTGGGTGGAAGTACATCTACACCGTGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ixopb3ew