dll4

Ensembl ID:
ENSDARG00000070425
ZFIN ID:
ZDB-GENE-041014-73
Description:
delta-like protein 4 [Source:RefSeq peptide;Acc:NP_001073304]
Human Orthologue:
DLL4
Human Description:
delta-like 4 (Drosophila) [Source:HGNC Symbol;Acc:2910]
Mouse Orthologue:
Dll4
Mouse Description:
delta-like 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1859388]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9436 Nonsense Available for shipment Available now
sa37051 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103320 Nonsense 205 683 4 11
Genomic Location (Zv9):
Chromosome 20 (position 28276856)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28348159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCCACTACACCTGCAACCCAGATGGCCRGTTATCCTGTCTCCCTGGCT[G/A]GAAGGGGGAATACTGCGAAGAACGTAAGCAATCAGAGWTCACAATTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103320 Nonsense 387 683 8 11
Genomic Location (Zv9):
Chromosome 20 (position 28280277)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28351580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGAGAAGGACAATGGACGCAGCTACGCATGTGAATGTCCTTTAGGCTA[C/A]ACGGGTCTTAACTGCGAGAGAAGGATGGACAAATGCACCAGTATGCTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link