si:dkey-184p18.2

Ensembl ID:
ENSDARG00000070413
ZFIN ID:
ZDB-GENE-060503-55
Description:
UPF0711 protein C18orf21 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q1LUS5]
Human Orthologue:
C18orf21
Human Description:
chromosome 18 open reading frame 21 [Source:HGNC Symbol;Acc:28802]
Mouse Orthologues:
2700062C07Rik, AC117232.1
Mouse Description:
RIKEN cDNA 2700062C07 gene Gene [Source:MGI Symbol;Acc:MGI:1915296]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23563 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093266 Nonsense 20 208 1 5
ENSDART00000133009   None 116 None 3
Genomic Location (Zv9):
Chromosome 19 (position 35670392)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 34529769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACTTTTTACTGAAGGCTTCTTTACTGTACAAAGACATTTGCCCTGAA[C/T]AGTCGCGCTTTCTCCTGTAAGTACACTTTAATTTTCATTTTCTATTCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link