mtmr7b

Ensembl ID:
ENSDARG00000070412
ZFIN ID:
ZDB-GENE-050913-66
Description:
myotubularin related protein 7b [Source:RefSeq peptide;Acc:NP_001025297]
Human Orthologue:
MTMR7
Human Description:
myotubularin related protein 7 [Source:HGNC Symbol;Acc:7454]
Mouse Orthologue:
Mtmr7
Mouse Description:
myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2007 Essential Splice Site F2 line generated During 2014
sa19458 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2007
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127370 Essential Splice Site 367 568 9 14
Genomic Location:
Chromosome 1 (position 15237878)
KASP Assay ID:
554-3245.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGTGTACTACTAGATCCCTACTACAGGACTATCAAGGGATTGATGGTA[G/A]TAACTGATATTTGATTCATGCAAGTGTATATGTCTGTGTGSAACAAACAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127370 Nonsense 385 568 11 14
Genomic Location:
Chromosome 1 (position 15234498)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATTCATATTAATATATGAGCTTTATTAAAATCTTCTACATACAGATA[T/A]GCTCATCTTGACGGCGACCCTAAAGAGGTTTCTCCAGTCATGGACCAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nxm09m85