mtmr7b

Ensembl ID:
ENSDARG00000070412
ZFIN ID:
ZDB-GENE-050913-66
Description:
myotubularin related protein 7b [Source:RefSeq peptide;Acc:NP_001025297]
Human Orthologue:
MTMR7
Human Description:
myotubularin related protein 7 [Source:HGNC Symbol;Acc:7454]
Mouse Orthologue:
Mtmr7
Mouse Description:
myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2007 Essential Splice Site F2 line generated During 2016
sa19458 Nonsense Available for shipment Available now
sa32635 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2007
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127370 Essential Splice Site 367 568 9 14
Genomic Location:
Chromosome 1 (position 15237878)
KASP Assay ID:
554-3245.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGTGTACTACTAGATCCCTACTACAGGACTATCAAGGGATTGATGGTA[G/A]TAACTGATATTTGATTCATGCAAGTGTATATGTCTGTGTGSAACAAACAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127370 Nonsense 385 568 11 14
Genomic Location:
Chromosome 1 (position 15234498)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATTCATATTAATATATGAGCTTTATTAAAATCTTCTACATACAGATA[T/A]GCTCATCTTGACGGCGACCCTAAAGAGGTTTCTCCAGTCATGGACCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127370 Nonsense 452 568 12 14
Genomic Location:
Chromosome 1 (position 15230714)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTATACTTTTATTTGTTTGTTTACTCATTCATTTTGCACTGTGCAGGT[T/A]ACAGGAGAGAACACACTCTCTGTGGCCACATCTGTGGGAGAACAGAGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link