il6r

Ensembl ID:
ENSDARG00000070398
ZFIN ID:
ZDB-GENE-080107-7
Description:
interleukin 6 receptor [Source:RefSeq peptide;Acc:NP_001107790]
Human Orthologue:
IL6R
Human Description:
interleukin 6 receptor [Source:HGNC Symbol;Acc:6019]
Mouse Orthologue:
Il6ra
Mouse Description:
interleukin 6 receptor, alpha Gene [Source:MGI Symbol;Acc:MGI:105304]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42709 Nonsense Mutation detected in F1 DNA During 2017
sa36110 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103256 Nonsense 39 604 2 10
Genomic Location (Zv9):
Chromosome 16 (position 24365488)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 18416462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAGTATTTTCTTCATCAAATCTTCATCAGATCCTCCTTCTGGAGTTT[T/A]GGTCTTGAATTTGGGAAGTAATGTTGTCCTTGGCTGCAGAGGTGATGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103256 Essential Splice Site 445 604 7 10
Genomic Location (Zv9):
Chromosome 16 (position 24359336)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 18410310
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATTTTGTAGCAACTAATGGTACCATTTATTTTTCCTGTTTCTTTGTA[G/T]CTCCTGAGACAACTACTGCCACTGAGACCATTACTTTTGTGAGTTCATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: Identification of IL6R and chromosome 11q13.5 as risk loci for asthma. (View Study)
  • C-reactive protein: Genetic Loci associated with C-reactive protein levels and risk of coronary heart disease. (View Study)
  • C-reactive protein: Loci related to metabolic-syndrome pathways including LEPR,HNF1A, IL6R, and GCKR associate with plasma C-reactive protein: the Women's Genome Health Study. (View Study)
  • C-reactive protein: Meta-analysis of genome-wide association studies in >80 000 subjects identifies multiple loci for C-reactive protein levels. (View Study)
  • Fibrinogen: Novel loci, including those related to Crohn disease, psoriasis, and inflammation, identified in a genome-wide association study of fibrinogen in 17 686 women: the Women's Genome Health Study. (View Study)
  • Protein quantitative trait loci: A genome-wide association study identifies protein quantitative trait loci (pQTLs). (View Study)
  • Pulmonary function: Framingham Heart Study genome-wide association: results for pulmonary function measures. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link